Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA122335 Similarity: 0.958 Similarity: 0.955 Similarity: 0.954
UTR: 5HSAA122335
Gene: ZNF211
MFE: -65.123
ENS: 0.940
Length: 156.
Predicted Ligands:
TPP - 6/20
cobalamin - 5/20
Mg2+ - 4/20
 RS: URS00023235EB_1081613
MFE: -54.322
Ligand: cobalamin
Species: Streptomyces albus subsp. albus DSM 41398 Cobalamin riboswitch
 RS: URS000232C789_1240678
MFE: -51.913
Ligand: cobalamin
Species: Streptomyces natalensis ATCC 27448 Cobalamin riboswitch
 RS: URS0000C0E673_1169855
MFE: -57.664
Ligand: TPP
Species: Rhodobacteraceae bacterium PD-2 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA122335 URS00023235EB_1081613 URS000232C789_1240678 URS0000C0E673_1169855
Length 156. 156. 157. 156.
Similarity - 0.958 0.955 0.954
Ensemble Norm 0.940 - - -
MFE -65.123 -54.322 -51.913 -57.664
Ligands - cobalamin cobalamin TPP
Gene ZNF211 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.006 4.006 8.001
Length SE - 0. 1. 0.
Lev Distance - 49. 57. 56.
UBS 15. 14. 14. 14.
BS 0. 0. 0. 0.
ILL 3. 4. 2. 5.
ILR 3. 4. 4. 3.
H 4. 4. 4. 3.
BL 6. 4. 6. 5.
BR 5. 3. 4. 6.
UN 0.006 0.083 0.083 0.045

Sequences

Field Description
UTR seq + 25 cggagguccguucugucugucagccgcuuugguacgcugcaucgggaucgaagugacggaccgugaaggcgcgagagucaggucugagggucgggggcagagccgcccgcgaggccggccuggggauagcgATGCTCGGGTTCCCCCCGGGTCGCC
UTR dot + 25 (((((…..))))).((.(((((((((((.(..((((.((.(((..(((……))).)))))..))))).)))))..)).)))).))(((.((((……)))).)))((.((((((((((..(((………)))..))))))))))))
RS 1 seq AGGUUCACCGAACUGCUGGGACUCUCCGGACGACAAAUCCAUACAUCGAGGCGACGGAAGCCAGGAACCCGGUGCGAAUCCGGGACGGUCCCGCCACUGUUACCGCCGGCCGCCGCCGCGCGGGAGUCAGGAACUGACCCGUCGUCCUCCUGCCAU
RS 1 dot .(((((…)))))((.((((((.((((((((.((…((…..((..(((…….)))..))….))))))..))))))..))))))))……..((((((((….)))).))))..(.(((((…(((…..))).))))).)..
RS 2 seq GAGCCACCCCCACAUGUAUGCUCGUGCUCGCUGUCGCCGCAGGGGAAUCCGGUGCGAAUCCGGAACUGUCCCGCAACGGUGUACGAGUGCGCCCGAUGCCCCCUACGGCCAUCCCGCGCCCUGAAGUCCGAGGACCUGCCGACAGUACGUCCGUGCC
RS 2 dot ((((.((……..))..))))..(((((.((.(((((..(((((.(((((…….)))))….)))).)..))))))))))))((((..((((((……))).)))..))))………((.((((.(((…..))).)))).))..
RS 3 seq CGCCGUACCUCGGGGUGGCAGGGUACCUGCCCCGUCCGGUCAGGAUCCGUUCCGCCGGUCGGGCCAUGCAAGACCUGUCUGAGAUUUGCGUAAGCGCAUCAACCCGUUGAACCUGAACCGGUUAACACCGGCGGAGGGAAGGUGAGGGCCGCGCGA
RS 3 dot (.(((…..))).).((((((…(.(((((((.(((((..(((…..)))))))).))))….))).).))))))……((((((..((.((((..(((.(((……..(((((….)))))))).)))..))))…)).))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table