Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA122406 Similarity: 0.931 Similarity: 0.931 Similarity: 0.927
UTR: 5HSAA122406
Gene: ZNF236
MFE: -60.109
ENS: 0.940
Length: 223.
Predicted Ligands:
cobalamin - 18/20
unknown - 2/20

 RS: URS00023358AF_1943632
MFE: -81.821
Ligand: cobalamin
Species: Pseudomonas sp. Bc-h Cobalamin riboswitch
 RS: URS000231EC4C_1897025
MFE: -79.266
Ligand: cobalamin
Species: Verrucomicrobia bacterium CAG:312_58_20 Cobalamin riboswitch
 RS: URS000232FC13_320497
MFE: -75.546
Ligand: cobalamin
Species: Neoasaia chiangmaiensis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA122406 URS00023358AF_1943632 URS000231EC4C_1897025 URS000232FC13_320497
Length 223. 223. 222. 223.
Similarity - 0.931 0.931 0.927
Ensemble Norm 0.940 - - -
MFE -60.109 -81.821 -79.266 -75.546
Ligands - cobalamin cobalamin cobalamin
Gene ZNF236 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.002 19. 4.
Length SE - 0. 1. 0.
Lev Distance - 87. 80. 97.
UBS 14. 16. 14. 15.
BS 0. 0. 0. 0.
ILL 2. 3. 5. 2.
ILR 2. 3. 4. 3.
H 7. 7. 5. 7.
BL 3. 5. 4. 4.
BR 4. 4. 3. 3.
UN 0.130 0.081 0.126 0.130

Sequences

Field Description
UTR seq + 25 gccuggaaacuacaaaggauuguguuaauuuuguguuuaggaagaaagagguaauggguaggaaucaauguaaacuuauucauaggccacaccaaaccaggaauucuugucgugauugcacuugguagaguuaacacacgugcacauuacggaaacguuggugaccaacaggcguuucagcgagcuuucgcacaccucATGCCGCGGGGCCGCCCCCCGAAGC
UTR dot + 25 .((((((…(((((((………..)))))))))))))……..(((.(((((((((…………)))))))))..)))………((((….)))).(((((((((((.((((…….)).)).))))).))))))((((((((.((…..)).)))))))).((((….))))………((..(((((…..)))))..))
RS 1 seq GUAGCCUUGCGCACUUGAGGUUCGCCGACCUGCCAUUACCGGCAGCGGCGCUAAGAAGGGAAUGUGGUUCAAGCCACAGCUGCCCCCGCAACUGUAAACGGUCAUGUUCAUUGCACAGCCACUGCGCGAGCGGGAAGGCGCGAUGAAUGCGAUUGGCCUGACGAAACCGUCAGUGCGAUUCGCUACCGUAAGCCAGGAGACCUGCCUCGAACAAUGGCCUGCC
RS 1 dot ..((((((……..))))))(((((..(((((……))))))))))…….(((..((((((….))))))….)))(((……….)))….(((((((((…(((.((((….))))…))))))))))))((((.(.((((((((….)))))).)).).))))….(((.((((.(((……)))……)))).))).
RS 2 seq UUUUAAAAUCCGACAGCCGGCAAUGAAGCAAGCCGGCGGCGACAUUUUCAGGCAAACGGAAGUCCGUGAGAAUCGGACGCGGUCGCGCCUCUGUAAUCGUCCUCAAAAUCCGGGCACAAAGCCACUGCGCAAAGCGCGGGAAGGCGCACGGAAGGCGGGCGGGAAUUUUCCUCCCCCCGCCGGGACGCAAGCCAGAAGACGUGCCUGGAAAUUUCCCUUUGG
RS 2 dot ……………((((((……….))))))(((((…….((((..((.(..(((((…….))))).).))…))))……)))))…….((((.((…..(((.((((((…))))))…))))).)))).((((((.((((…….))))))))))((((……((((………))))…..))))…..
RS 3 seq CGAUAAUAAACGUUCGACGGUGCCCUUUCGUUAUCGAAAGGGUUAAAAGGGAAUACGGUGAAGGUGUUCGCAUCGCAAGCCGUAGCUGCCCCCGCAACUGUAAGCGAUAGCUUCAUCUCCACACGCGGCAACAGCGCGGGUCACUGAUCGAGGACGAUCGGGAAGGCUUGGAAUGGGGUCAUCAUUCGCGAGCCAGGAAACCUGCCGUCGGCAUUGUUGCGAG
RS 3 dot (((……….)))…..(((((((((….)))))))))…..(.((((((…….)))))).)……..((((.((((…((((…(((((((….))))…….))).))))…)))))))).((.(((((((….))))))))).((((((((((((…..)))))).))))))….(((.((((…))))..)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table