Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA122559 Similarity: 0.975 Similarity: 0.971 Similarity: 0.970
UTR: 5HSAA122559
Gene: ZNF281
MFE: -46.456
ENS: 0.813
Length: 130.
Predicted Ligands:
FMN - 9/20
cobalamin - 7/20
SAM - 2/20
 RS: URS0000C5F13F_1629715
MFE: -33.967
Ligand: FMN
Species: Peptococcaceae bacterium BRH_c8a FMN riboswitch (RFN element)
 RS: URS0000C366E8_1549855
MFE: -51.092
Ligand: TPP
Species: Haematospirillum jordaniae TPP riboswitch (THI element)
 RS: URS0000DA1EE2_1121421
MFE: -40.016
Ligand: FMN
Species: Desulfotomaculum aeronauticum DSM 10349 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA122559 URS0000C5F13F_1629715 URS0000C366E8_1549855 URS0000DA1EE2_1121421
Length 130. 130. 129. 131.
Similarity - 0.975 0.971 0.970
Ensemble Norm 0.813 - - -
MFE -46.456 -33.967 -51.092 -40.016
Ligands - FMN TPP FMN
Gene ZNF281 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 4.001 6.002
Length SE - 0. 1. 1.
Lev Distance - 33. 36. 37.
UBS 10. 9. 11. 10.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 3.
ILR 4. 4. 3. 5.
H 1. 1. 1. 1.
BL 5. 4. 5. 3.
BR 3. 2. 4. 3.
UN 0.085 0.062 0.062 0.046

Sequences

Field Description
UTR seq + 25 uaauuccauuguggagaggacggcguuauuuuuauuaacuggaggcgacggcggcugcggcggcggcgggacccguaaguauugccgccaggccuccuccgggguATGAAAATCGGCAGTGGGTTCCTGA
UTR dot + 25 ….((((((((.((………….(((((((…(((((((.(.((((((((((.((((.(……)))))..)))..)))))).)..).)))))))…))))))))).))))))))…….
RS 1 seq UAAAACCUUCAGGGACAGGUGAAAUUCCGUACCGGCGGUAAGAGGUUAAGCUUCAAGCCCGCGAGCCCGCAAGGGUUGAUCCGGUGUAACUCCGGAGCCGACAGUAAAGUCUGGAUGGGAGAAGGUAAUU
RS 1 dot ….((((((…………..((((((.((((((((….(((((.(((((((.((.(((….)))..)).))))…))).)))))…..))))……….))))))))))))))))….
RS 2 seq CGCUGUUCCGAGGGGUGCCCCCGUCCGUUUUCACAUCCGGGCCAAGGCGCUGAGAUCUGGCUGACUGGCCGGAAACCCUUUGAACCUGAUCCGGGUCAUACCGGCGGAGGGACAGGAACAGCAAGGAGC
RS 2 dot .((((((((……((((((((.(((…….(((((((.(.(((..(.(((.(((((((….)))))))….))).)..)))).)))))))…..)))))).))).))))))))))…….
RS 3 seq AUAAACCUUCAGGGUUAGGUGCAAUUCCUUACCGGCGGUAUGGCGCUUUCAGCCGAGCCCGCGAGCCCGUAAGGGCAGAUCUGGUGAGAAGCCAGAGCCGACAGUUAAAGUCUGGAUGGGAGAAGGUUGAU
RS 3 dot …(((((((……………((((..((((((((.((((..(((((.(.(((((((((….)))..))))…)).).))))).))))..))))………..))))..)))))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table