Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA122589 Similarity: 0.985 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA122589
Gene: ZNF292
MFE: -17.321
ENS: 0.965
Length: 66.
Predicted Ligands:
fluoride - 8/20
homocysteine - 4/20
unknown - 3/20
 RS: URS0000BE1E3D_96561
MFE: -17.429
Ligand: fluoride
Species: Desulfococcus oleovorans Hxd3 Fluoride riboswitch
 RS: URS0000AB3540_76114
MFE: -15.876
Ligand: homocysteine
Species: Aromatoleum aromaticum EbN1 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000D68BD0_485916
MFE: -14.889
Ligand: unknown
Species: Desulfotomaculum acetoxidans DSM 771 DUF1646 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA122589 URS0000BE1E3D_96561 URS0000AB3540_76114 URS0000D68BD0_485916
Length 66. 67. 66. 66.
Similarity - 0.985 0.984 0.984
Ensemble Norm 0.965 - - -
MFE -17.321 -17.429 -15.876 -14.889
Ligands - fluoride homocysteine unknown
Gene ZNF292 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.002 11.074 5.006
Length SE - 1. 0. 0.
Lev Distance - 17. 17. 20.
UBS 6. 6. 5. 5.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 0.
ILR 0. 1. 0. 0.
H 2. 2. 1. 3.
BL 3. 4. 3. 2.
BR 3. 1. 0. 2.
UN 0.152 0.194 0.424 0.076

Sequences

Field Description
UTR seq + 25 cacgugacccaggugcguacgcgacggagcggggugugaagATGGCGGACGAAGAGGCCGAGCAGG
UTR dot + 25 (((…((((.(.(.(((…..))).).).)))))))….((((……….))))……
RS 1 seq AGAAACGAUGGGGAUGGGGUCCCCCGACAACCGCCGCACUGGACAGGCUGAUGACUCCUGCCGAUAC
RS 1 dot ……..((.((.(((.(((….)))..))))).)).(((.((((………)))))))….
RS 2 seq CCUGCCGAGGAGCGCUGCGAGACUUCCGUCCCAGGCUCGGCCCUUCAAAAACUGCGCUCACCUUAA
RS 2 dot …(((…((((.(((.(.(((….))))))))))))))…………………….
RS 3 seq GGCUGGGCGAGUUAAUUUGUAUUUAUUCGCUUUCACAAGUGAUUUACGACUUCUGGGUGGGAAGCC
RS 3 dot ….((((((((.(((….))).)))))))).((.((((……..)))).))(((…..)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table