Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA122590 Similarity: 0.987 Similarity: 0.986 Similarity: 0.985
UTR: 5HSAA122590
Gene: ZNF292_0
MFE: -19.491
ENS: 0.992
Length: 68.
Predicted Ligands:
homocysteine - 10/20
fluoride - 7/20
glutamine - 2/20
 RS: URS0000C090CF_34073
MFE: -19.517
Ligand: homocysteine
Species: Variovorax paradoxus S-adenosyl-L-homocysteine riboswitch
 RS: URS0000C3146E_1198452
MFE: -15.833
Ligand: homocysteine
Species: Janthinobacterium sp. HH01 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000C32F22_1736266
MFE: -18.764
Ligand: homocysteine
Species: Duganella sp. Leaf126 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA122590 URS0000C090CF_34073 URS0000C3146E_1198452 URS0000C32F22_1736266
Length 68. 69. 69. 67.
Similarity - 0.987 0.986 0.985
Ensemble Norm 0.992 - - -
MFE -19.491 -19.517 -15.833 -18.764
Ligands - homocysteine homocysteine homocysteine
Gene ZNF292 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.005 2.010 9.004
Length SE - 1. 1. 1.
Lev Distance - 16. 17. 16.
UBS 6. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 1. 2. 0. 1.
ILR 0. 0. 1. 0.
H 2. 2. 2. 2.
BL 3. 2. 3. 3.
BR 3. 2. 3. 0.
UN 0.147 0.217 0.246 0.209

Sequences

Field Description
UTR seq + 25 aucacgugacccaggugcguacgcgacggagcggggugugaagATGGCGGACGAAGAGGCCGAGCAGG
UTR dot + 25 .((((…((((.(.(.(((…..))).).).))))))))…((((……….))))……
RS 1 seq CGUUCCGAGGAGCGUUGCAGCGCCGCCAGGCGUGAGGCUCGGACCACAUCGCAACCACGCUCACCCGCU
RS 1 dot .(.(((…((((.((…(((((….))))))).))))))).)…..((……))………
RS 2 seq CCUUCCGAGGAGCGUUGCGACGAAUCACGAAUUCGCCAGGCUCGGAGUCCCAAACCGCGCUCACGUUAC
RS 2 dot ………((((.(.((((((…..))…)))).).)))).((((.(……).))))…….
RS 3 seq UGUUCCGAGGAGCGCUGCGACGAAUCCUUUUCGCCAGGCUCGGAAUCUGCAACCGCGCUCACGUUAC
RS 3 dot .(((((…((((.(((.(.((((…..)))))))))))))))))..((….))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table