Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA122759 Similarity: 0.975 Similarity: 0.973 Similarity: 0.972
UTR: 5HSAA122759
Gene: ZNF345
MFE: -11.561
ENS: 0.908
Length: 122.
Predicted Ligands:
molybdenum - 12/20
Ni/Co - 3/20
FMN - 2/20
 RS: URS0000D78653_156994
MFE: -26.970
Ligand: SAM
Species: Reichenbachiella agariperforans SAM riboswitch (S box leader)
 RS: URS0000DB0138_1121429
MFE: -37.962
Ligand: molybdenum
Species: Desulfotomaculum putei DSM 12395 Moco (molybdenum cofactor) riboswitch
 RS: URS000232141A_1703937
MFE: -41.791
Ligand: cobalamin
Species: Streptomyces sp. CB03234 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA122759 URS0000D78653_156994 URS0000DB0138_1121429 URS000232141A_1703937
Length 122. 123. 122. 121.
Similarity - 0.975 0.973 0.972
Ensemble Norm 0.908 - - -
MFE -11.561 -26.970 -37.962 -41.791
Ligands - SAM molybdenum cobalamin
Gene ZNF345 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 7.002 23.001
Length SE - 1. 0. 1.
Lev Distance - 32. 34. 29.
UBS 6. 6. 5. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 0. 1.
ILR 2. 2. 0. 1.
H 3. 2. 3. 3.
BL 1. 1. 2. 4.
BR 1. 1. 1. 4.
UN 0.303 0.285 0.262 0.273

Sequences

Field Description
UTR seq + 25 agcaacacaaguagacuaaggcaucaaguuuuaccacuuaagauuaaggugacuaugaaucaaaguugagaccaagaaauuauuucugaaaaaggauATGGAAAACCTTACAAAACACAGCA
UTR dot + 25 ……………….((..((((.(((((((…………)))))……….)).))))..)).(((((…)))))….((((……….))))………….
RS 1 seq CACUUAUCAAGAAAGAUCGAGGGACUGGGCCCGAAGACAUCUUGGCAACAUAUCCAUAGCCGCAAUAUUGGAUGUUGUGCCAACUCCCAUUCUAGAUGCGAAUAUCUGGAUAUAAGAUAGGUA
RS 1 dot ………………..((((…(((.(…(((((((((((…………))))…….)))))))).)))…))))..((((((((….))))))))………….
RS 2 seq UAAUACUUAACACUCCGAGCUUCUGGACCUACGAUAUUAUGCAUUACGGUCCUGAAGCCGAUAGGGUUUGUCUGGAAACGGACAGGCCUCCCGGUGCGGAAAGGAGGGAAUUGACAGCGAUC
RS 2 dot ……………((.(((((.(((((………………))))).)))))))….((((((((((….))))))))))((((………….))))………….
RS 3 seq GAACACACAACUUCACCAGGGCGGCAGGGCCCAGGAAGCCGGUGCGAAUCCGGCACGGUCCCGCCACUGUGACUCAGGCUCCGCCUGACAGUCAGGAACUGACCUGUCGCCUUUCUUUCCG
RS 3 dot …………….((.((.(((.(((((……(((((…….)))))..))))).))).)).))..((((((…))))))..(.((((……)))).)………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table