Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA122761-2 Similarity: 0.989 Similarity: 0.988 Similarity: 0.984
UTR: 5HSAA122761-2
Gene: ZNF346
MFE: -26.051
ENS: 0.959
Length: 72.
Predicted Ligands:
cobalamin - 8/20
GMP - 5/20
2'-dG-II - 2/20
 RS: URS0000D699CD_12908
MFE: -22.660
Ligand: GMP
Species: unclassified sequences c-di-GMP-I-GGC riboswitch
 RS: URS0000C40716_1449976
MFE: -28.549
Ligand: cobalamin
Species: Kutzneria albida DSM 43870 Cobalamin riboswitch
 RS: URS0000C82742_110319
MFE: -24.336
Ligand: cobalamin
Species: Nocardioides sp. CF8 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA122761-2 URS0000D699CD_12908 URS0000C40716_1449976 URS0000C82742_110319
Length 72. 73. 72. 72.
Similarity - 0.989 0.988 0.984
Ensemble Norm 0.959 - - -
MFE -26.051 -22.660 -28.549 -24.336
Ligands - GMP cobalamin cobalamin
Gene ZNF346 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 4.005 7.005
Length SE - 1. 0. 0.
Lev Distance - 13. 15. 19.
UBS 4. 5. 5. 5.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 1. 2. 1. 1.
H 2. 2. 2. 3.
BL 2. 3. 1. 0.
BR 1. 1. 0. 1.
UN 0.292 0.301 0.222 0.222

Sequences

Field Description
UTR seq + 25 aaaucucgcgauaccuaggcgccugagaggcucucuaccggugagggATGGAGTATCCCGCGCCGGCCACGG
UTR dot + 25 ……………((((.((((…))))..))))((((((.((((((…)))))).))))))……
RS 1 seq CAAGAUAAAGCCAAACCUGCCGUGAGACAGGGCGGGAAGCAACGGGUCUCAAUAGAUAGCCGAGUUGCCUCUU
RS 1 dot ……………((((((.((…)).))))))..(((((.(((.((….))..)))..)))))…..
RS 2 seq GAGGAACCCGGUGCGAGUCCGGGGCGGUCGCGCCACUGUGAUCGACCCACGCGGGUCGGCAGCCAGAGACUC
RS 2 dot ………(((((((..(((…)))))))))).(((((.(((((((….)))))))))..)))……
RS 3 seq AUGAGGAACCCGGUGAGACUCCGGGGCGGUUCCGCCACUGUGAAAUCCCGUAGGGGAUUCAGCCAGACACUC
RS 3 dot ………((((…….))))((((….)))).((((..((((((….))))))..)).))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table