Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA122903 Similarity: 0.984 Similarity: 0.983 Similarity: 0.982
UTR: 5HSAA122903
Gene: ZNF407
MFE: -10.081
ENS: 0.852
Length: 82.
Predicted Ligands:
SAM - 6/20
zmp-ztp - 6/20
cyclic-di-GMP - 2/20
 RS: URS0000DB53BA_1798803
MFE: -16.350
Ligand: SAM
Species: Alkalibacterium sp. 20 SMK box translational riboswitch (SAM-III)
 RS: URS0000C1E651_1262756
MFE: -24.053
Ligand: zmp-ztp
Species: Blautia sp. CAG:257 ZMP/ZTP riboswitch
 RS: URS0000C3D4BA_747377
MFE: -16.754
Ligand: zmp-ztp
Species: Clostridium sp. DMHC 10 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA122903 URS0000DB53BA_1798803 URS0000C1E651_1262756 URS0000C3D4BA_747377
Length 82. 82. 82. 81.
Similarity - 0.984 0.983 0.982
Ensemble Norm 0.852 - - -
MFE -10.081 -16.350 -24.053 -16.754
Ligands - SAM zmp-ztp zmp-ztp
Gene ZNF407 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.007 7.005 7.007
Length SE - 0. 0. 1.
Lev Distance - 19. 21. 20.
UBS 6. 7. 5. 6.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 1.
ILR 4. 2. 2. 2.
H 1. 1. 2. 2.
BL 2. 4. 2. 2.
BR 1. 1. 1. 2.
UN 0.244 0.329 0.171 0.160

Sequences

Field Description
UTR seq + 25 acagguuaugagugccagugagccgccuuagauagaagcaucgucagcacuuuauuaATGATGGATAGTGAGAATAAACCCG
UTR dot + 25 .((.((((.((((((…(((((..(……..)..)).)))…))))))…))))..))……………….
RS 1 seq AAGGUUUACAAAGAAUUCCCGAUAGGACGGCCACAACCGGUCGGAAGCCUUGUAACCGAGAAAAUAAGGGGGAAUAAUAAUG
RS 1 dot ..(((.(((.(((..((.(((((.((..(….)..)).)))))))..)))))))))…………………….
RS 2 seq UAACGACUGCAUGACUGGCGGAAAACAGGAAUUACCUGUGGGGAGUGCAGUAAGUGAUAAGCCGACCGCCUGGGCAGCCUGA
RS 2 dot ..((.(((((((..((.((((…………..)))).))..)))))))..))…..(((………)))…….
RS 3 seq AAUCGAUUAUAUGACCGGCGGAAGUGGAAUAACCACAGGGAGUAUGAUUUUGAUAGAGAGCCGACCGCCUGGGCAAAUUUA
RS 3 dot .(((((((((((..((.(.((………..)).).))..))))))))..)))…..(((………)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table