Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA122929 Similarity: 0.966 Similarity: 0.965 Similarity: 0.964
UTR: 5HSAA122929
Gene: ZNF415
MFE: -34.935
ENS: 0.973
Length: 129.
Predicted Ligands:
cobalamin - 6/20
FMN - 4/20
SAM - 4/20
 RS: URS0000DB34BC_83656
MFE: -53.280
Ligand: cobalamin
Species: Streptomyces tsukubaensis Cobalamin riboswitch
 RS: URS0000D90029_630515
MFE: -50.515
Ligand: FMN
Species: Microlunatus soli FMN riboswitch (RFN element)
 RS: URS0000AB3FB1_12908
MFE: -29.322
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA122929 URS0000DB34BC_83656 URS0000D90029_630515 URS0000AB3FB1_12908
Length 129. 128. 130. 130.
Similarity - 0.966 0.965 0.964
Ensemble Norm 0.973 - - -
MFE -34.935 -53.280 -50.515 -29.322
Ligands - cobalamin FMN cobalamin
Gene ZNF415 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.001 8.001 7.001
Length SE - 1. 1. 1.
Lev Distance - 40. 42. 45.
UBS 9. 9. 10. 10.
BS 0. 0. 0. 0.
ILL 2. 4. 1. 2.
ILR 2. 3. 1. 4.
H 3. 3. 5. 3.
BL 3. 1. 3. 2.
BR 2. 1. 1. 3.
UN 0.062 0.086 0.085 0.085

Sequences

Field Description
UTR seq + 25 aaacggaucgcguugggugaaggugacggcgucgagccauugacuuccaaagacuccuggcacaugaggaagaaacccagaagaggagagcaaaggagucaggaATGACTGTACGTCAGGTAAGTCATT
UTR dot + 25 ….((.((((((((………..))))).))).))..(((((((……(((((……((.((……))))….)))))……)))))))..(((((((.(((…..))))))))))
RS 1 seq AGAGGAAGUCGGUGCGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGGAGUACCCCCCACACGGAAGUCACGGCCCCUGACCGGGCUGGAAGGCCGGGGGGUGCGGGGAUCCGGGAGCCAGGAGACUC
RS 1 dot ……..((((((((…..((((……))))..)).))))))…(((((((((….((…((.((((((……))))))))…)))))))))))(((..(((……..)))..)))
RS 2 seq CUGCGUGCUCUGGGGUCGGUGAAACUCCGAGCCGGCGGUGACAGUCCGCGACCCGUUCACAACCAGUGAGCGGUUGACCAGGUGAAACUCCUGGACCGACGGUGAAAGUCCGGAUGGGAAGCGCACGCGG
RS 2 dot …((.((((.(((((…….)))))))))))((((…….))))…((((((((…..))))))))….(((((…….))))).(((.(((((….(((…..)))..))).)))))
RS 3 seq GUAUUGAAGUACUUGGUGGGGAAUCAAUGUGCAAUUCAUUGGCUGUACCUGCAACCGUAAAGUCGGAGUGCCACCCAAUAUAGCCCGCUGAGAAUGAUGGCCAGGAAAAGCCUAGUUCUACAAUGAAAAA
RS 3 dot ….(((((((((((((…..))))).))))..))))..(((((((…(((.(((……)))..)))…….)))))))((.(((((((…(((……..)))..))))).)).))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table