Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA123102 Similarity: 0.982 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA123102
Gene: ZNF480
MFE: -26.273
ENS: 0.951
Length: 95.
Predicted Ligands:
glycine - 7/20
TPP - 6/20
purine - 3/20
 RS: URS0000AB977F_500633
MFE: -19.207
Ligand: glycine
Species: Clostridium hiranonis DSM 13275 Glycine riboswitch
 RS: URS0000AB6B66_1262699
MFE: -20.307
Ligand: glycine
Species: Anaerostipes sp. CAG:276 Glycine riboswitch
 RS: URS0000ABAFCA_610130
MFE: -14.013
Ligand: purine
Species: Clostridium saccharolyticum WM1 Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA123102 URS0000AB977F_500633 URS0000AB6B66_1262699 URS0000ABAFCA_610130
Length 95. 95. 94. 96.
Similarity - 0.982 0.981 0.981
Ensemble Norm 0.951 - - -
MFE -26.273 -19.207 -20.307 -14.013
Ligands - glycine glycine purine
Gene ZNF480 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9. 8. 2.027
Length SE - 0. 1. 1.
Lev Distance - 22. 22. 24.
UBS 4. 6. 6. 3.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 0. 1. 0. 0.
H 3. 3. 3. 3.
BL 0. 0. 0. 0.
BR 0. 2. 2. 0.
UN 0.316 0.295 0.298 0.479

Sequences

Field Description
UTR seq + 25 ucccacaaacccggaagcggaucgcguggagugaaggucacgccgcggcgcgauugacuucuaaagagucATGCTGTGTGATGAAAAAGCCCAGA
UTR dot + 25 ……….(((….)))…((((((……..))))))(((((((….((((((…..)))))))))))))……………..
RS 1 seq AUUAGGAACUCUGGAGAGUCUCCAAAAAAGGGGCGCCGAAGGUGUACGCAAACUAAGUUUGCAAAUCUCUCAGGCAAAAGGACAGAGCAGUAAGG
RS 1 dot …….((((….))))((((……)))).(((((((((….((((((…))))))..)))).)).)))………………..
RS 2 seq UAUAUACACUCUGGAGAGUCUCAAAGAAAGAGCGCCGAAGGUGUACGGCAGCGCAGGCUGUUUAUCUCUCAGGCAAAAGGACAGAGCAGACAUA
RS 2 dot …….((((….))))(((…….))).((((((((((…((((((….))))))))))).)).)))………………..
RS 3 seq AUAGAAUAAAGCUGUUGCGCUUAUAUAAGUUCAUAAUCGGUUGAGCGUUUCUACCAACUACCAUAAUAGUUGACUAUAAGGGUUAAAAGGAAAAAG
RS 3 dot ……..((((……))))……(((((……..)))))……..((((((……))))))……………………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table