Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA123103 Similarity: 0.986 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA123103
Gene: ZNF480_0
MFE: -28.578
ENS: 0.956
Length: 99.
Predicted Ligands:
purine - 16/20
TPP - 4/20

 RS: URS0000C0BE48_759620
MFE: -16.342
Ligand: purine
Species: Weissella sp. 1119-1A-09 Purine riboswitch
 RS: URS0000BF8934_1736411
MFE: -12.361
Ligand: purine
Species: Paenibacillus sp. Soil787 Purine riboswitch
 RS: URS0000C4FCB0_1184387
MFE: -25.299
Ligand: purine
Species: Mesotoga prima Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA123103 URS0000C0BE48_759620 URS0000BF8934_1736411 URS0000C4FCB0_1184387
Length 99. 99. 100. 99.
Similarity - 0.986 0.984 0.984
Ensemble Norm 0.956 - - -
MFE -28.578 -16.342 -12.361 -25.299
Ligands - purine purine purine
Gene ZNF480 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.008 17. 2.033
Length SE - 0. 1. 0.
Lev Distance - 18. 15. 21.
UBS 4. 4. 6. 3.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 0. 1. 0. 0.
H 3. 3. 3. 3.
BL 0. 0. 2. 0.
BR 0. 0. 3. 0.
UN 0.232 0.323 0.230 0.414

Sequences

Field Description
UTR seq + 25 aguuucccacaaacccggaagcggaucgcguggagugaaggucacgccgcggcgcgauugacuucuaaagagucATGCTGTGTGATGAAAAAGCCCAGA
UTR dot + 25 .((((((………))))))…..((((((……..))))))(((((((….((((((…..)))))))))))))……………..
RS 1 seq ACAAAUCAAAUAACGCUUGAGAGUAUAAUAGUUGGAGAAUGGCCAACGAGUAUCUACCUUUGUCCCUAGACGAAGACUACUCCCUUAAACGAAAACACC
RS 1 dot …..((((…….))))……….(((((…….)))))(((((…..(((((((….)))))))..)))))……………..
RS 2 seq GGAACUGAAUACUACCCAUUUCGUAUAACCUUAAUAAUUGGAUUAAGGGUCUCUACUUAGAAACCGUAAAUUUCUAGCUACGACAAAUGUGCGCAUGUCA
RS 2 dot .(((.((………)).)))……(((((((……)))))))(((..((.(((((((…….))))))).)).)))…………….
RS 3 seq AGGUGAUAGAAUCCAUUUACCCGUAUAAUCCCGCGAAUCGGCGCGGGAGUUUCUACAGAAGGCCAUAACCUUCUUUCUACGGCGUGCAUUAAUACUACC
RS 3 dot .(((((……….)))))…….(((((((……)))))))……..((((((……))))))…………………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table