Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA123114 Similarity: 0.971 Similarity: 0.970 Similarity: 0.969
UTR: 5HSAA123114
Gene: ZNF484
MFE: -32.743
ENS: 0.751
Length: 121.
Predicted Ligands:
SAM - 12/20
TPP - 3/20
cobalamin - 1/20
 RS: URS00023148F7_1797384
MFE: -30.253
Ligand: cobalamin
Species: Bdellovibrionales bacterium GWA2_49_15 Cobalamin riboswitch
 RS: URS0000D69391_12908
MFE: -26.391
Ligand: GMP
Species: unclassified sequences c-di-GMP-I-UAC riboswitch
 RS: URS0000C7B026_1262775
MFE: -40.641
Ligand: FMN
Species: Clostridium sp. CAG:138 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA123114 URS00023148F7_1797384 URS0000D69391_12908 URS0000C7B026_1262775
Length 121. 121. 122. 120.
Similarity - 0.971 0.970 0.969
Ensemble Norm 0.751 - - -
MFE -32.743 -30.253 -26.391 -40.641
Ligands - cobalamin GMP FMN
Gene ZNF484 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 20. 10.004
Length SE - 0. 1. 1.
Lev Distance - 38. 33. 37.
UBS 6. 7. 9. 6.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 1.
ILR 3. 3. 4. 1.
H 2. 2. 2. 4.
BL 1. 1. 2. 1.
BR 0. 0. 3. 1.
UN 0.198 0.198 0.213 0.258

Sequences

Field Description
UTR seq + 25 cccgaggcaaaugaccacuguccugagaggacgugggugaggggcaggugaguagagggauggcagcaucuguggacugagcaagaagaaucucugATGTCTGTCCTGAGCCTTCCGGAAT
UTR dot + 25 …………..((((.(((((…)))))))))((..((((((((….((((((((((….)))))………………..)))))…))))))))..))……….
RS 1 seq CUUAUAGUCCGCUGAUAUUUUACAGGUAUUUCAGAAGGAAUCUGGUGUGAAUCCAGAGCUGUGCCGCAACGGUAAUCCCAUUUGGGUAAGCCCGGGCGACUGAGGUACUAAUUUCCCGAGC
RS 1 dot ………..(((……..)))(((((((((..(…(((((.((..((((((((((((……)))))…….)))))))..))))))))..)))))))))………….
RS 2 seq UAGAUACAAUGUAAACCUGGUGAAAAUCAGGGGCACAAAGCUAUAGGGUCUAAGAGGUCCCAGGGAACGGGGAUCACGUCCGGACGGAAAUAUCGGAAGCUUAUGACAGCCAGCUGCAAGGA
RS 2 dot ……………((((((….))))))(((.(((((((…((((((..((((((((.(….).))))))…)).))))…….))…))))).))…)))………..
RS 3 seq AUCAGUCUUCGAGGCGGGGCGAAGUUCCCCACCGGCGGUCACAGUCCGCAAGCGGCUUUUGCCGCACGAUCCGGUGAAAUUCCGGUACCGACGGUCACAGUCCGGAUGAGAGAAGCUGUG
RS 3 dot …………((.((((…….)))).)).((((…….))))..(((((….)))))…((((((…….(((…….)))…….))))))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table