Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA123464 Similarity: 0.963 Similarity: 0.959 Similarity: 0.959
UTR: 5HSAA123464
Gene: ZNF585B
MFE: -29.249
ENS: 0.847
Length: 161.
Predicted Ligands:
TPP - 14/20
molybdenum - 2/20
glucosamine - 1/20
 RS: URS0000C018B7_36847
MFE: -42.979
Ligand: glucosamine
Species: Clostridium neopropionicum glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000C5F0FA_1600
MFE: -37.111
Ligand: Mg2+
Species: Lactobacillus acetotolerans M-box riboswitch (ykoK leader)
 RS: URS0000C192F0_765440
MFE: -50.169
Ligand: TPP
Species: Piloderma croceum F 1598 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA123464 URS0000C018B7_36847 URS0000C5F0FA_1600 URS0000C192F0_765440
Length 161. 159. 161. 162.
Similarity - 0.963 0.959 0.959
Ensemble Norm 0.847 - - -
MFE -29.249 -42.979 -37.111 -50.169
Ligands - glucosamine Mg2+ TPP
Gene ZNF585B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 11.003 15.007
Length SE - 4. 0. 1.
Lev Distance - 43. 50. 47.
UBS 11. 10. 13. 10.
BS 0. 0. 0. 0.
ILL 5. 4. 6. 2.
ILR 4. 3. 6. 4.
H 2. 2. 2. 3.
BL 3. 3. 2. 1.
BR 2. 2. 3. 2.
UN 0.124 0.151 0.180 0.210

Sequences

Field Description
UTR seq + 25 auuucgccgcuggcgucaggacuauuuucacguuuuaaugccgagagguauauagguaccauuuucaaagaaaugauguucugagcccuauaagcacaaucaauaugcaucacaagagacaaacuguaaucucugaATGCCAGCTAGTTGGACCTCACCCC
UTR dot + 25 ……..((((((.(((((((.((…..((((((..((..(((.(((((….))))).))).))..))))))))))))))))))…..))).((((……((((….(((((……….)))))..))))……))))………..
RS 1 seq UUGAAAAAUGAAGCGCCAGAACCGCAGAUAGGGCGGUUGACGAGGUAGAAGUGAUCGAAUUUUUCGGCGGAUGCUUCUCGCCCAUUCGUUCAGGGACGCAGGUCUUUCUACAAAUAGGAGAAGGUAAUUCUUCUGACAAAGGGAAAGGCAACGGACGAA
RS 1 dot …………(((((.((((….(((.((((((…..((((((….((.(((((…)))))))..))))))))))))))).))))..)).)))..((((((((…..((((((((…..))))))))……))))))))……….
RS 2 seq CAAAUAAACUGUUAGGUGAGACUCCUACGUGAACACACGCUAUUGCCCGGAAACAUCCAGAGAUGCCAACGGGUUAAGUAGGUGUCGUCGACUUAAGGCGGGAUCCAGAUAGCUAGGCAUUUACGUCACAUAGUGUUAAAACUGAACGACGAGUAUAAAAA
RS 2 dot ……..(((((..(.((..(((((..((..((((((.((((((((((….((((….))))….)))))..))))))))).))..))…))).))..))).)))))………..((((…((((……))))…))))……….
RS 3 seq UGGAAUGGCUGCGGGUAUCCCUGUCUGUGAUGAUGUUUCUCAUUCGCUAGUCGUUUAGACAUUUGGUUUGAAUGAGACCAUCGAAAACAGCAGGGGUUGAGAUCACACCGCUUGAACCUGAACAGCGCUCAUACCUGCGUAGGGAAGCCCCCAGUGUCGUUU
RS 3 dot ……….(((((((((((((.((((..(((((..(((((((((((((((…..)))…))))..)))))))).)))))…)))))))))))…….)).))))………….((((……..)))).(((…..)))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table