Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA123481 Similarity: 0.955 Similarity: 0.953 Similarity: 0.951
UTR: 5HSAA123481
Gene: ZNF594
MFE: -66.421
ENS: 0.830
Length: 181.
Predicted Ligands:
lysine - 17/20
FMN - 1/20
cobalamin - 1/20
 RS: URS0000AB28CD_720555
MFE: -53.486
Ligand: lysine
Species: Bacillus atrophaeus 1942 Lysine riboswitch
 RS: URS0000C61CE0_1423820
MFE: -48.071
Ligand: lysine
Species: Lactobacillus aviarius subsp. araffinosus DSM 20653 Lysine riboswitch
 RS: URS0000AB9AA7_326442
MFE: -45.601
Ligand: FMN
Species: Pseudoalteromonas haloplanktis TAC125 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA123481 URS0000AB28CD_720555 URS0000C61CE0_1423820 URS0000AB9AA7_326442
Length 181. 181. 180. 181.
Similarity - 0.955 0.953 0.951
Ensemble Norm 0.830 - - -
MFE -66.421 -53.486 -48.071 -45.601
Ligands - lysine lysine FMN
Gene ZNF594 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15. 4.001 6.004
Length SE - 0. 1. 0.
Lev Distance - 53. 60. 64.
UBS 11. 10. 11. 12.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 2.
ILR 1. 3. 2. 1.
H 5. 5. 4. 5.
BL 2. 2. 2. 4.
BR 4. 1. 3. 5.
UN 0.133 0.144 0.167 0.199

Sequences

Field Description
UTR seq + 25 agucccggggagcgcaccggaaguucucgccuggcccaggcgcgggguccaagaugguggcgcuaggagccgcgacccagugauagcggccguggaggggcccccgaccgagcgggagguuggggguagccuggagauucugaagacaggaauaagATGAAGGAATGGAAATCAAAGATGG
UTR dot + 25 ….((((……..))))…..(((.((((((((…(((.(((((…….(((((…….)))))))))).)))…).))))).)).)))((((((((((……..))))))))))..((((………….))))…..(((…………)))……..
RS 1 seq CAGUGAGGUAGAGGUUGCGCGGAUGAUAAGUCACACAUGCCAGGCUGACAGGGAGCUGUUAAACAUGUGUAAAAGGCAUCAGCGCCGAAGUGUGAAGAAAGCCGAUCCUUCUUCAUGCUGGGACUGUAUCUGAAUAAGUGCAGGACUGCCGCGUGCUUUUUCGCGGAGGGCUAUCCGGAGA
RS 1 dot …………….((((.((((…….(((((((……((((((….))))))..)))))))……)))).))))…(((((((((((………)))))))))))((..(((((.((…..)))))))..)).(((((……..))))).((…..))…..
RS 2 seq ACAUCGAAGAGAGGUCGCACUGCUUAUCAGUAGCCUUCAUGAAUUGCUAAAGCAAUGGUGAUUGAGGGUGAAAGGAAUCGGUGCCGAAGUGAUUGAUUGCUUUAGAGGUCAACCGCUGGGGUCUAGCUUAAGAGGCUAGGAACUGUCGCAGUGAAAACAUUGCGGAGCGCUAUCGAAAGU
RS 2 dot …………..(((((((((((.((….(((((((…(((((((……)))))))))))))))).)))…)))))).))((((.((((((……..)))))).))))((..((((((((…))))))))..)).((((((((….))))))))……………
RS 3 seq GUACAUUCUCAGGGCGGGGCGAAAUUCCCCACCGGCGGUAUGUUUAAUUCACUAUUUUAAUUACAUUUGUAGUGUUUAAAUAAGCCCGCGAGCGCUUUGUUGUUUUAUAUAAUAUCAAAGGUCAGCAGAUCUGGUGAGAUGCCAGAGCCGACGGUUACAGUCCGGAUGAAAGAGAAUAUGG
RS 3 dot …………((.((((…….)))).))…(((.(((((((..((((((………….)))))).))))))).))).((..((.(((((.((((……)))).)))))))..))…((((((…..)))))).(((((…….))).))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table