Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA123523 Similarity: 0.981 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA123523
Gene: ZNF611
MFE: -21.191
ENS: 0.997
Length: 98.
Predicted Ligands:
purine - 9/20
TPP - 6/20
glycine - 3/20
 RS: URS0000D8772A_1945860
MFE: -28.004
Ligand: glycine
Species: Rhodanobacter sp. B04 Glycine riboswitch
 RS: URS0000C84F03_135735
MFE: -16.897
Ligand: TPP
Species: Bacillus endophyticus TPP riboswitch (THI element)
 RS: URS0000BF638A_1850362
MFE: -17.010
Ligand: purine
Species: Bacillus sp. FJAT-27264 Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA123523 URS0000D8772A_1945860 URS0000C84F03_135735 URS0000BF638A_1850362
Length 98. 98. 99. 99.
Similarity - 0.981 0.980 0.979
Ensemble Norm 0.997 - - -
MFE -21.191 -28.004 -16.897 -17.010
Ligands - glycine TPP purine
Gene ZNF611 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.005 11.002 14.003
Length SE - 0. 1. 1.
Lev Distance - 22. 22. 22.
UBS 7. 8. 8. 6.
BS 0. 0. 0. 0.
ILL 0. 2. 0. 0.
ILR 0. 2. 0. 2.
H 2. 2. 2. 2.
BL 3. 3. 6. 3.
BR 5. 4. 4. 2.
UN 0.265 0.194 0.313 0.212

Sequences

Field Description
UTR seq + 25 agauuaacgcaaacccggaagcggaucggguggaguguaggucauaucgccgcggauugauuccuaaagacucATGATGAAGGAGGTCTTGTCAACAG
UTR dot + 25 …………….((((.(((.((((((((.(((…..))).))))).))).))).))))..(((((((………))).))))……..
RS 1 seq CGUAAACACUCUGGAGAGAGCGGUUGAAUCCGCCGCCGAAGGUGCACGAGACGUAUCCGCGUCUCCAAACUCUCAGGCAAAAGGACAGAGGGGCGCCC
RS 1 dot ………..((((((..((((.((..((((.((((…))))..)).))..)).)))).))))))..(((((.(………).)))))……
RS 2 seq AAUAUUUUACAGGGGAACUCAUACGAGUUGAGAAGGUAAAAACCUGACCCUUUGAACCUGAGAGUUAAUACUCGCGUAGGGAGUAAAAGUAUACAGUUU
RS 2 dot ……………(((((.((.(.(((.(((.(((………))).))).)))))).)))))..(((((.(…).)))))…………..
RS 3 seq UGAAUUGAAUAAGCCUUUUUUCGUAUAUCCUUAAUAAUGGGUUUAAGGGUCUCUACUGGAAACCGUAAAUUUCCGGCUACGAAAAUAUGCUGCGGCAUA
RS 3 dot ……………..((((((((.((((((((……..))))))))…))).)))))(((((.((((.((….)).))))….)))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table