Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA123524 Similarity: 0.941 Similarity: 0.937 Similarity: 0.936
UTR: 5HSAA123524
Gene: ZNF611_0
MFE: -54.150
ENS: 0.961
Length: 215.
Predicted Ligands:
cobalamin - 15/20
glucosamine - 4/20
TPP - 1/20
 RS: URS0002326C66_1262779
MFE: -65.024
Ligand: cobalamin
Species: Clostridium sp. CAG:217 Cobalamin riboswitch
 RS: URS000054601E_451755
MFE: -44.128
Ligand: glucosamine
Species: Clostridium perfringens E str. JGS1987 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000ABBCA8_1073571
MFE: -62.093
Ligand: glucosamine
Species: Paenibacillus riograndensis SBR5 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA123524 URS0002326C66_1262779 URS000054601E_451755 URS0000ABBCA8_1073571
Length 215. 214. 215. 214.
Similarity - 0.941 0.937 0.936
Ensemble Norm 0.961 - - -
MFE -54.150 -65.024 -44.128 -62.093
Ligands - cobalamin glucosamine glucosamine
Gene ZNF611 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 7.001 6.001
Length SE - 1. 0. 1.
Lev Distance - 73. 81. 81.
UBS 15. 16. 14. 15.
BS 0. 0. 0. 0.
ILL 4. 5. 4. 5.
ILR 5. 3. 4. 3.
H 4. 5. 4. 5.
BL 4. 4. 5. 4.
BR 5. 6. 3. 5.
UN 0.116 0.136 0.140 0.093

Sequences

Field Description
UTR seq + 25 gcuuuuguccugcgcgcgcagauuaacgcaaacccggaagcggaucggguggaguguaggucauaucgccgcguugacuagauaacgaaggacaaugcauauauacaaaauugcuguauugccuggugauaugcagcuguaccugugacaucauaauugcacccuccgacaugauaucucuuccaaaugcATGATGAAGGAGGTCTTGTCAACAG
UTR dot + 25 ((..((((((((((((((..((((.((((..((((((…….))))))…)))).))))….))).))))…………..))))))).))…………..(((((((………..)))))))((((..((((….))))..))))……((((.(((.((.((((((……))..)))))).))).))))…..
RS 1 seq ACAAUUUAGCGUGCGUUUGGUGCCUUUGCGCGCCCCGCCAAAGGCUGAAAAGGGAAUCCGGUGGGAAUCCGGAGCAGCCCGAACCUCUACUGUAUUUGCCGACAAGAAAGCACCGCCGUUUGGGUAACGGCAGCCAUUGCUCCCCCGGGAGUGAGAAGGCCGCUUUUGCGAAUGAAGCAUAAGUCAGGAGACCUGCCGCGCACGAGCUGUUGUU
RS 1 dot ….((((((.((((…(((((……))))).)))…).))))))..((((((.(((((((….(((……)))….))))))).)))).))…………..((((((…..)))))).(((.(((((((….)))))))…))).((((.((((..((..(((…(((….))).))))))))).))))…….
RS 2 seq UAAUAGAUUAAAGCGCCAGAACUUAAAGUUUUAUUGAUAGACUAAUAAGUAAUUUAACUCUAGUAGAUUAAAAUAUAUUAGAAUUCUUAAGAGUUUAAGUUGACGAGGUUGGGGAGUAUCGAAUUUUCGGCGGAUGCCCCACGGUAAAGCACUACCGUAAAAGAUUGGUUAAAGCUUAAAAGUGAUUUUAAGGACAAAGCCAAUUGGGUGUUUAA
RS 2 dot …………..(((.(((((((((.(((((..((….(((((..(((.(((((.(((…)))))))).))))))))…)).))))).))))))))..)..)))..(((.(((((…………))))))))((((((……))))))….((((((((….(((((((….)))))))…..))))))))……….
RS 3 seq UGGCAACAGCAAGCGCCAGAGCUUGAUCUUGCGCGGGGGAGAAGGGACAGCAGUUGCCUAUAGGGCAAGGCUUGAACGGAUCACGGCAGAUGUAAGCUGACGAGGUGGAGGUGUUCGAAAUGUUCGGCGGGGACCUCCCGGUGAUGCACCAGAGCCGUAAAUGGAAGCGGAAAAUGCGAGGGCGACCUUUCACACAACGUUUCUGUGGGUGCAA
RS 3 dot ((((……….)))).(((((((((.(((.((…((……..(((..((((((…)))))).)))……..)).)))))))).))))))……..((((((.((((……….)))).))))))((((..((…))..))))…(((((((((…..((.((((….)))).))…..)))))))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table