Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA123535 Similarity: 0.962 Similarity: 0.962 Similarity: 0.961
UTR: 5HSAA123535
Gene: ZNF615
MFE: -38.078
ENS: 0.782
Length: 150.
Predicted Ligands:
FMN - 13/20
SAM - 2/20
cobalamin - 2/20
 RS: URS0000C3936C_1736489
MFE: -56.276
Ligand: FMN
Species: Duganella sp. Root198D2 FMN riboswitch (RFN element)
 RS: URS0000AB4A2B_196162
MFE: -66.823
Ligand: SAM
Species: Nocardioides sp. JS614 SAM riboswitch (S box leader)
 RS: URS0000C7471B_766136
MFE: -39.334
Ligand: FMN
Species: low GC Gram-positive bacterium strain AHT28 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA123535 URS0000C3936C_1736489 URS0000AB4A2B_196162 URS0000C7471B_766136
Length 150. 151. 149. 150.
Similarity - 0.962 0.962 0.961
Ensemble Norm 0.782 - - -
MFE -38.078 -56.276 -66.823 -39.334
Ligands - FMN SAM FMN
Gene ZNF615 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.006 14.013 11.010
Length SE - 1. 1. 0.
Lev Distance - 46. 45. 48.
UBS 8. 10. 10. 9.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 2.
ILR 1. 2. 3. 3.
H 3. 5. 3. 5.
BL 1. 2. 3. 1.
BR 2. 2. 3. 1.
UN 0.313 0.238 0.201 0.213

Sequences

Field Description
UTR seq + 25 aaacgcugggaacgccuccgacccuggauagucgccgucaggcacugaggaggccgagagaugaggccggagcccaccaaguucugggaaguucuuucugacacaaguaagauaacaucucugccATGAGGCCGGAGCCCACCAAGTTCT
UTR dot + 25 ………….((((((..(…….(((.(((….))))))).)))))).((((((…..(((((((…….)))))))…..))))))………………..(((((((….))).))))………….
RS 1 seq UUACGUCUUCGGGGCGGGGUGCGAUUCCCCACCGGCGGUAAGAGCGGCAACGUUCGAGCCCGCGAGCGCCUGCCUGGCAGCAACGGGCAGGGUCAGCAGACCUGGUGAGAUUCCAGGGCCGACGGUAUAGUCCGGAUGAAAGAAGAUGUGC
RS 1 dot …………((.((((…….)))).))…(((..(((((….)))))..))).((..((.((((((((…….))))))))))..))…(((((…….))))).(((((……))).))…………….
RS 2 seq AGCUCAUCAAGAGGGACUGAGGGAUACGGCCCUGUGAAGUCCCGGCAACCGCCGCGAUCCUCCGCCGCCCGGCAUCCAGCCAGGAAGCGGUUCGCGGAAACGGUGCCAAUUCCGCCCGGGGCGACCGCCGCACCCGGGGAAGAUGAGAA
RS 2 dot …………((((((.((((……))))….))))))(((.((((((((((….((((..((.(((…..))).))..)))).))))))…)))))))…….(((((((((…..))).))))))………..
RS 3 seq UGAACUGACAAGGGGCAGGGUGUAAUUCCCGACCGGCGGUAACGUGCAUAACGAAGCCCGCGAGCUGUUUCGCUAAAUGAUUUAGUGUAAAUGGCAGAUUUGGUGUAAAACCAAAGCCGACAGUUAAAGUCUGGAUGGGAUAUCAGUUUA
RS 3 dot ………….((..(((…….)))..)).((((…(((…..)))….))))..((((((((((((((…))))))).)))))))…((((((…..)))))).(((.(((…….)))..)))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table