Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA123537 Similarity: 0.983 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA123537
Gene: ZNF615_0
MFE: -23.592
ENS: 0.919
Length: 85.
Predicted Ligands:
GMP - 5/20
TPP - 4/20
homocysteine - 4/20
 RS: URS00023325DA_53376
MFE: -26.081
Ligand: TPP
Species: Mycobacterium heidelbergense TPP riboswitch (THI element)
 RS: URS0000C05CA1_767434
MFE: -29.746
Ligand: homocysteine
Species: Frateuria aurantia DSM 6220 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000C34E21_1262883
MFE: -17.992
Ligand: zmp-ztp
Species: Eubacterium sp. CAG:192 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA123537 URS00023325DA_53376 URS0000C05CA1_767434 URS0000C34E21_1262883
Length 85. 85. 86. 86.
Similarity - 0.983 0.983 0.983
Ensemble Norm 0.919 - - -
MFE -23.592 -26.081 -29.746 -17.992
Ligands - TPP homocysteine zmp-ztp
Gene ZNF615 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 5. 3.
Length SE - 0. 1. 1.
Lev Distance - 21. 20. 21.
UBS 9. 9. 7. 8.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 2.
ILR 3. 2. 2. 3.
H 1. 1. 1. 1.
BL 3. 4. 3. 4.
BR 4. 5. 4. 3.
UN 0.129 0.141 0.128 0.128

Sequences

Field Description
UTR seq + 25 aaacgcugggaacgccuccgacccuggauagucgccgucaggcacugaggaggccgagagATGAGGCCGGAGCCCACCAAGTTCT
UTR dot + 25 ….(.((((..((((((((.((((…((((.(((….))))))).)).)).))……)))))..)..)))).)…….
RS 1 seq CACGGGAGUCCCGGGAGCGGGGUCUGAGAGUGGGCGCGCCUGUCCUUACCGUCGAACCUGAUCCGGAUCAUGCCGGCGAAGGGAG
RS 1 dot ..(((.((..(((((..((((.((.((..(((((.((….)).)))))..)))).)))).)))))..).).)))……….
RS 2 seq CUCACCGAGGAGCGUUGCGACCGUGGCAGCUUCCUGUCCCCGGCCAGGCUCGGUGUGGCGGCCUUGUGCAACGGCGCUCGAUCAUG
RS 2 dot …..((((..((((((((.((((.(((.(..((((……..))))…).))).))))…..))))))).).))))……
RS 3 seq AAUCGUCCAUGCGACUGGCGGAUAAGUGGAGUUCACCACAGGGAGCAUGGUUUUAAGAAUGUAAGUCGACCGCCUGGGCAACCUCU
RS 3 dot ….(((((.(((..((((..((((((.(.((((.((…)))))).).)))…….)))..))))..))).)))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table