Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA123594 Similarity: 0.956 Similarity: 0.948 Similarity: 0.948
UTR: 5HSAA123594
Gene: ZNF644
MFE: -60.689
ENS: 0.842
Length: 167.
Predicted Ligands:
lysine - 4/20
Mg2+ - 3/20
TPP - 3/20
 RS: URS0000C24AAC_927083
MFE: -83.245
Ligand: cobalamin
Species: Sandaracinus amylolyticus Cobalamin riboswitch
 RS: URS0000E60305_1263011
MFE: -46.560
Ligand: unknown
Species: Firmicutes bacterium CAG:238 raiA RNA
 RS: URS0000DB3932_1761907
MFE: -45.010
Ligand: SAM
Species: Thermoactinomyces sp. DSM 45891 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA123594 URS0000C24AAC_927083 URS0000E60305_1263011 URS0000DB3932_1761907
Length 167. 166. 166. 169.
Similarity - 0.956 0.948 0.948
Ensemble Norm 0.842 - - -
MFE -60.689 -83.245 -46.560 -45.010
Ligands - cobalamin unknown SAM
Gene ZNF644 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 13. 7.001
Length SE - 1. 1. 4.
Lev Distance - 51. 60. 60.
UBS 15. 14. 15. 15.
BS 0. 0. 0. 0.
ILL 2. 2. 4. 3.
ILR 2. 2. 4. 4.
H 4. 3. 4. 3.
BL 8. 6. 6. 8.
BR 5. 7. 4. 4.
UN 0.102 0.108 0.090 0.136

Sequences

Field Description
UTR seq + 25 cuggaggcgaaaagcggggagcggaggggggccgcuggagccgaguagcguacagagcggcgugugacgcggggacgccgcgugcucccaacgucgccccgguuugacgcacacggcaccaaacuguuugauuuaauuuuggATGTTAATAAGACAAAATCTAGCCT
UTR dot + 25 ……((…..))….(((((…….)))))((.((((.((.((((.((((.(((.(.((((((..(((((((…))).))))..)))))))))).)))))))))).)))).))…..(((.(((((..(((((……..)))))..))))).)))..
RS 1 seq AAGAGGGAAGCCGGUGAGAAGCCGGCGCGGCCCCCGCCACUGUGACCGGGGACGGCGCGGACGCGGUGCGAGCGCACCGAGUCACCACUGCGCGUGCUCGUCGUGUGAGCGGCGGGGCGCGGCGGGAAGGUGGUCCGCGACGGACGAUCCGGGAGCCAGGAGACCU
RS 1 dot ………((((((…..))))))(((.((((((((((..(((.((((.((.((((((((.((((((….)))))).)))…..))))))).))))))).))).)))).))).)))(((…..(((.(((((…))))).)))…..)))………
RS 2 seq ACCGUCUGCGUCUGUGGUUGAAAAUCCAAGCCAGGUGCGGGCAAAAGGAUCCACGUAAGCCGUCGCGCAGGAGAUCGGGCGGUGAUCAUGGCGUACCUUAGAAGUAAGUCCUCCGAAAAUCGGGUAAAGGCAAGUGUGGGGGCAAAGACCAGGUCAGGCAGGCGGU
RS 2 dot …(((((((((((.(.(((……))).))))))))))))…(((((..((.((((..((.((((..(.(((((…..))))).).))))))))))…))..)))))((((…))))……((..((.(((((…….))…))).))..))…
RS 3 seq UUCUUAUCCAGAGUGGCGGAGGGACUGGCCCGAUGAUGCCCGGCAACCCAUUAAAUGCUUGCGAUUUGAUCCAACUUGUCGACAAAUUUGAUUUAUCGACAACUCGAUCAGAGAAGGAAGCUUUGAUAAGGUGCUAAUUCCUGCAGAGAAAUUCUCUGAGAGAUGAGAC
RS 3 dot ……..((..(.(((.(……).))))..))……(((.(((.((((((.((((.(..(((((((….(((((((.((((…)))).)))))))…)))))))…).))))))))))..))))))…((((.((((((…)))))))).))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table