Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA123709 Similarity: 0.950 Similarity: 0.949 Similarity: 0.949
UTR: 5HSAA123709
Gene: ZNF687
MFE: -66.348
ENS: 0.771
Length: 196.
Predicted Ligands:
cobalamin - 20/20 - 20/20


RS: URS000231794E_99158
MFE: -65.808
Ligand: cobalamin
Species: Hammondia hammondi Cobalamin riboswitch
RS: URS000231AC28_485916
MFE: -65.793
Ligand: cobalamin
Species: Desulfotomaculum acetoxidans DSM 771 Cobalamin riboswitch
RS: URS000232580F_1121338
MFE: -42.913
Ligand: cobalamin
Species: Clostridium tepidiprofundi DSM 19306 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA123709 URS000231794E_99158 URS000231AC28_485916 URS000232580F_1121338
Length 196. 195. 195. 196.
Similarity - 0.950 0.949 0.949
Ensemble Norm 0.771 - - -
MFE -66.348 -65.808 -65.793 -42.913
Ligands - cobalamin cobalamin cobalamin
Gene ZNF687 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 5. 8.
Length SE - 1. 1. 0.
Lev Distance - 64. 64. 64.
UBS 15. 15. 14. 14.
BS 0. 0. 0. 0.
ILL 5. 4. 6. 4.
ILR 4. 4. 5. 3.
H 3. 3. 3. 5.
BL 5. 4. 4. 5.
BR 5. 6. 4. 4.
UN 0.107 0.144 0.118 0.102

Sequences

Field Description
UTR seq + 25 auuccuuccaugcuccaaaucccgugccccguccacgcccucccgcagagggaggagcgacggguuacgcugucgcccaggagcugaaccgcgcgaggaccccauccaucagauuauauggcgauuuagacggugggaagaccgcaaggaaauggucugggaucugccgauATGGGGGATATGAAGACCCCTGATT
UTR dot + 25 ……..((.(((((……((((.((((((…((((((((…..)))))).)))))))).))))……….)))))))..((..(((…..((((.((.(((((((…….))))).)).))))))…..)))..))….(((((…((((.((…..)).))))….)))))…….
RS 1 seq CCUAUCAAUUUCGGCGACGGUUCCCUUCGGGGAUCAAAAGGGAAUGCGGUGCGAGGGUAACCCAAUGCCGCAGCUGUCCCCGCAACUGUAAACGGCGAGCCUUUCGUCAAUUUGCCACUGGGCUACUCAGCUCGGGAAGGCGUCAACAGGCGAUGACCCGUGAGCCAGGAGACCUGCCGUCAGUCGUGGUCACAC
RS 1 dot …………(((((.((((((((((((((((……((..((((((….(((…)))…)))))).))))))))).))……..)).)))))..)))))…..(((.(((((((….)))))))…)))…….(((.(((((…((((.((((…)))).).)))))))).)))….
RS 2 seq AAUUUAAUCGUUUAUUCAGGUUCCCCGGGUUAUGCCGGGGUAAGAGGGAACCGGGUGAGAAUCCCGGACGGUCCGGCCACUGUAAGCGGGGAGCGGCUCCCAAAAUGUCACUGGGUAUUUGAAUAACCCGGGAAGACGGGGAGUGGGCAGUGAUGAUCCACGAGUCAGGAGACCUGCUUGGAUAAUGAUCAGGUG
RS 2 dot ……………….((((((((..((((((((((.(….((((..(……)..))))….).))))))….)))).)))))))).((((((….((((.((((((………))))))…))))))))))..((..((((.((…((((.((((…))))))))….)).)))).)).
RS 3 seq GUUAAUUUGCAAUUUUUAGGUAUUAAUGGGGUAUUCUCAUUAAUUUAAAAGGGAAACAGGUUAGAAUCCUGUACGGUCCCGCCGCUGUGUUGAGGAGCCUUUAUACAUUUUGCCACUGGUUUUCAUUUAAAAACUGGGAAGGAGUAUAAAGAUGAUGAAUCUAAGUCAGAAGACCUGCCUAAAAAUUCAGCGCUUU
RS 3 dot ………….((((((..(((((((((…..)))))))))))))))((((.(((((…….)))))….))))((..((……))..))((((((((.((((.((…((((((……)))))))).)))).))))))))..(.(((((…((.(((…..))).))….))))).)…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table