Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA123710 Similarity: 0.988 Similarity: 0.988 Similarity: 0.986
UTR: 5HSAA123710
Gene: ZNF687_0
MFE: -10.979
ENS: 0.980
Length: 42.
Predicted Ligands:
SAM - 14/20
preQ_1 - 5/20
zmp-ztp - 1/20
 RS: URS0000C2DD64_67855
MFE: -8.833
Ligand: preQ_1
Species: Actinobacillus muris PreQ1 riboswitch
 RS: URS000232AFD4_1797678
MFE: -15.
Ligand: zmp-ztp
Species: Clostridiales bacterium GWC2_40_7 ZMP/ZTP riboswitch
 RS: URS0000ABBAC0_1321606
MFE: -5.042
Ligand: preQ_1
Species: Bacillus selenatarsenatis SF-1 PreQ1 riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA123710 URS0000C2DD64_67855 URS000232AFD4_1797678 URS0000ABBAC0_1321606
Length 42. 44. 43. 43.
Similarity - 0.988 0.988 0.986
Ensemble Norm 0.980 - - -
MFE -10.979 -8.833 -15. -5.042
Ligands - preQ_1 zmp-ztp preQ_1
Gene ZNF687 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 1.001 10.195
Length SE - 4. 1. 1.
Lev Distance - 11. 15. 15.
UBS 4. 3. 4. 2.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 0.
ILR 1. 1. 1. 0.
H 1. 1. 1. 1.
BL 2. 1. 2. 1.
BR 2. 1. 2. 0.
UN 0.024 0.045 0. 0.465

Sequences

Field Description
UTR seq + 25 gucugggaucugccgauATGGGGGATATGAAGACCCCTGATT
UTR dot + 25 (((.(((((((.((…..)).))))……..))).))).
RS 1 seq UUGUUCGUGGUUCGUGAACCUCCCACGCAAAAAACUAAGGAUAU
RS 1 dot .(((((.(((((((((…….))))…..))))).))))).
RS 2 seq GUCGUGCGACUGGCGGAAGUGGAUUAACCACAGGGAGCACGAC
RS 2 dot (((((((..((.(.((………..)).).))..)))))))
RS 3 seq ACGGAAGAGGUUCUAGCUACCCUCUCAAAAAAACUAAGGGAAA
RS 3 dot …(.(((((……….))))))……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table