Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA123714 Similarity: 0.964 Similarity: 0.960 Similarity: 0.958
UTR: 5HSAA123714
Gene: ZNF688
MFE: -55.459
ENS: 0.942
Length: 157.
Predicted Ligands:
FMN - 13/20
SAM - 6/20
Mg2+ - 1/20
 RS: URS0000C7926B_1076934
MFE: -47.811
Ligand: FMN
Species: Streptococcus lutetiensis 033 FMN riboswitch (RFN element)
 RS: URS0000C52CC4_1423776
MFE: -39.099
Ligand: FMN
Species: Lactobacillus odoratitofui DSM 19909 = JCM 15043 FMN riboswitch (RFN element)
 RS: URS0000C11D9A_1120927
MFE: -41.895
Ligand: FMN
Species: Acinetobacter tandoii DSM 14970 = CIP 107469 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA123714 URS0000C7926B_1076934 URS0000C52CC4_1423776 URS0000C11D9A_1120927
Length 157. 157. 156. 156.
Similarity - 0.964 0.960 0.958
Ensemble Norm 0.942 - - -
MFE -55.459 -47.811 -39.099 -41.895
Ligands - FMN FMN FMN
Gene ZNF688 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.001 12.013 9.003
Length SE - 0. 1. 1.
Lev Distance - 44. 47. 51.
UBS 11. 11. 11. 10.
BS 0. 0. 0. 0.
ILL 1. 3. 3. 2.
ILR 3. 3. 3. 2.
H 5. 4. 5. 6.
BL 4. 2. 2. 2.
BR 3. 3. 1. 2.
UN 0.096 0.127 0.212 0.147

Sequences

Field Description
UTR seq + 25 uucuaccgcggguguacacaugguuugccagggugugcgcgucuucccaaggggucuggggaccaaauuccagcucccgccaucgggaggcacgguaagagaccguaggggacacaaucccgagcaccgcagATGCCGAGGTCTCCGCTGCGCTCCA
UTR dot + 25 ………..((((((((.(((….)))..))))))))(((((((…((((.(((((……..))))).))))……)))))))(((((…..)))))..((((…..))))((((.(.((((((……))))..)).).))))..
RS 1 seq GAGUGUCUUCAGGGCAGGGUGCAAUUCCCGACCGGCGGUGUUGCCUUUCGUUGUUUGCUAAGAGAACGAGAGCAAUAUAAAAGUCCGCGAGCUGCUUGGCAGUUGAUCUGGUGAGAUUCCAGAACCGACAGUAAAGUCUGGAUGGGAGAAGACCAAG
RS 1 dot …………((..(((…….)))..)).(((((((((.((((((((.(((….))).)))))))))))))…….)))).((((((…))))))….((((….(((((…(((((……))).)).)))))….))))..
RS 2 seq AGAUUUCUUCGGGGCAGGGUGAAAUUCCCGACCGACGGUGACAGUUAGAUUGAACGCUUGAUCGUGUUAAGACUGAAGUCCGUGACCCACGUUUUCGUGGUUGACCCAGUGCGAGUCUGGGACCGACAGUUAAAGUCUGGAUGGGAGAAGAAAGUG
RS 2 dot …………((..(((…….)))..)).(((((..(((((…(((.((((……))))))))))))..).))))…(((((….)))))….(((((…….))))).(((.(((…….)))..)))…………
RS 3 seq CAUCGCUUCAGGGCGGGGUGUAAUUCCCCACCGGUGGUAAUUUCAGCACAAUAUUUAAAGUACUGAUUUAGCCCACGAGCAUGUAGCCUUAAAACUGCAUGCAGAUUUGGUUCAAUGCCAAAGCCGACGGUAUAGUCCGGAUGAAAGAAGACGACG
RS 3 dot ………..((.((((…….)))).)).((((…..((((.((……….)).))))……))))..((((((((……..))))))))…((((((…..))))))…(((……)))((..(……)..))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table