Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA123849 Similarity: 0.965 Similarity: 0.965 Similarity: 0.965
UTR: 5HSAA123849
Gene: ZNF75D
MFE: -42.991
ENS: 0.903
Length: 143.
Predicted Ligands:
TPP - 9/20
cobalamin - 5/20
FMN - 4/20
 RS: URS0000BF7CBA_692275
MFE: -37.309
Ligand: TPP
Species: Sphaerulina musiva SO2202 TPP riboswitch (THI element)
 RS: URS0000C0DB63_253628
MFE: -46.345
Ligand: TPP
Species: Ochroconis gallopava TPP riboswitch (THI element)
 RS: URS0000D9F52F_47885
MFE: -59.889
Ligand: homocysteine
Species: Pseudomonas oryzihabitans S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA123849 URS0000BF7CBA_692275 URS0000C0DB63_253628 URS0000D9F52F_47885
Length 143. 143. 144. 143.
Similarity - 0.965 0.965 0.965
Ensemble Norm 0.903 - - -
MFE -42.991 -37.309 -46.345 -59.889
Ligands - TPP TPP homocysteine
Gene ZNF75D - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.007 7. 18.
Length SE - 0. 1. 0.
Lev Distance - 45. 43. 39.
UBS 10. 10. 11. 12.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 3.
ILR 3. 3. 4. 1.
H 3. 3. 3. 3.
BL 4. 2. 2. 1.
BR 3. 2. 2. 4.
UN 0.070 0.154 0.076 0.063

Sequences

Field Description
UTR seq + 25 ugcucuugggaagaacaauucauugauuugguaccaaccugaugcacccugauuugucaaaggugguaccaggugggugucagugucacauacaagaguaaaacuguuccuagagcaaATGGCGATGAGAGAGCTGAACGCGG
UTR dot + 25 ((((((((……(((…((((.((((((((((.((((…(((……..)))…)))))))))))))).))))….)))……))))))))….(((((…)))))….(((.(.((….)).).)))..
RS 1 seq UCAAAUGCAUGCGGGUGUUCACUUGUCUCUGUUGUAAUCAUGAGUCUCCUCGGAGCGUGAUAUGGGCAGGACAGUGAUCUGAGAUAUACCGUACGAACCUGAACAGAGUAAUUUCUGCGGAGGGACAUGCUUUCAUCCCCUUA
RS 1 dot ………(((((((((((((.((((.(((((…((((((..((…..))..))))))…)))))))))))))……)))).)))))……….(((((….)))))..(((((..(((….))).))))).
RS 2 seq CAUUGCAUGAGCCGGUGUUCGUCACAUCCGCUGUGCGACUGAAGACCGGAAGAGCUUCUGAAGUUGCGCAGUGUGGCGAUCUGAGAUUAUACGGCUGAACUUGAUCUGGAUAAUUCCAGCGAAAGAAUCAUGCAGAGCGUUGAG
RS 2 dot …….(.((((.(((((((((((….(((((((((((((((..(….)..))))…))))))))))))))))))………)))))))).).(((…(((((….)))))…)))..((((((…)))).)).
RS 3 seq CCGUUCGAGGGGCGCUGCAGCACGCUGCGUUAUCCCAUCCUAGCCGACCCGCCCCUGGCGCGGGACCCUCGGCGGGCAUGACGCCAGACGUUGUCAGGCUCGAACGGAGCGUUGUCAGAACGCAUCAACGGCGCCCAUUCGCA
RS 3 dot ((((((((…((.(((((..(((((((((((((((……((((((((((…….)))))….)))))))).)))))).))).))))).))))))))))))).(((((…..)))))…….(((……))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table