Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA123917 Similarity: 0.981 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA123917
Gene: ZNF780A_0
MFE: -23.334
ENS: 0.969
Length: 103.
Predicted Ligands:
purine - 11/20
TPP - 6/20
Ni/Co - 1/20
RS: URS0000AB8690_1064535
MFE: -24.738
Ligand: TPP
Species: Megasphaera elsdenii DSM 20460 TPP riboswitch (THI element)
RS: URS0000AB78EE_888051
MFE: -30.886
Ligand: TPP
Species: Actinomyces sp. oral taxon 178 str. F0338 TPP riboswitch (THI element)
RS: URS0000AB4B34_521098
MFE: -36.263
Ligand: purine
Species: Alicyclobacillus acidocaldarius subsp. acidocaldarius DSM 446 Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA123917 URS0000AB8690_1064535 URS0000AB78EE_888051 URS0000AB4B34_521098
Length 103. 104. 103. 102.
Similarity - 0.981 0.980 0.980
Ensemble Norm 0.969 - - -
MFE -23.334 -24.738 -30.886 -36.263
Ligands - TPP TPP purine
Gene ZNF780A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 2.016 2.002
Length SE - 1. 0. 1.
Lev Distance - 23. 26. 25.
UBS 6. 7. 6. 6.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 1.
ILR 1. 2. 1. 1.
H 4. 4. 5. 4.
BL 0. 1. 0. 1.
BR 1. 1. 0. 0.
UN 0.146 0.135 0.272 0.098

Sequences

Field Description
UTR seq + 25 acuuccggucuccggggucgacgacauagcggggggagaagcccgaggaagauugaccaguuuuguaauucuagcaacATGGTCCATGGATCAGTGACATTCA
UTR dot + 25 ….((((…))))((((((……..((((……..))))…….))))))….((((…….))))(((((((….))))).))…….
RS 1 seq AGAAAAAGCUAGGGGAGCCUUCGGGCUGAGAAAAGUGACGGAUUACACUUGACCCUUUACCUGAUGCGGAUCAUGCCGCCGUAGGGAAGCUUUACGGGAUUAUA
RS 1 dot …….(((…..)))(.(((((..(((..(((((……..)))))….)))..))))).)(((……)))((((((((…))))))))…….
RS 2 seq CCACUGUGCCACGGGAGCUCACGACGAGCUGAGAAGGGGAUGGACCCCGACCGUUGAACCUGAACCGGACCAUACCGGCGUAGGAAGGCUUCUUCCCUCGUGG
RS 2 dot …((((…)))).(((((…..)))))…..((((…..))))…………….((((……))))((..(((((….)))))..))…
RS 3 seq AUGGGUGCGUAAUCCGAGACUCGUAUAAUGCCGGGAAUAUGGCCCGGCAGUCUCUACGAGGCGACCGUAAAUCGCCUUGCUACGAGGUCGGGCAGGAACGUC
RS 3 dot .(((((…..)))))…((((((…(((((((…….)))))))…..))))))((((…….))))((((((.((….))))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table