Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA123977 Similarity: 0.978 Similarity: 0.977 Similarity: 0.977
UTR: 5HSAA123977
Gene: ZNF808
MFE: -27.422
ENS: 0.999
Length: 104.
Predicted Ligands:
SAM - 12/20
purine - 5/20
TPP - 2/20
RS: URS0000C72626_1655566
MFE: -37.242
Ligand: SAM
Species: Acidimicrobium sp. BACL19 MAG-120924-bin39 SAM-I/IV variant riboswitch
RS: URS0000C50AB8_1286171
MFE: -30.299
Ligand: SAM
Species: Peptoclostridium acidaminophilum DSM 3953 SAM riboswitch (S box leader)
RS: URS0000C45D40_1346330
MFE: -32.698
Ligand: SAM
Species: Sphingobacterium paucimobilis HER1398 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA123977 URS0000C72626_1655566 URS0000C50AB8_1286171 URS0000C45D40_1346330
Length 104. 104. 104. 104.
Similarity - 0.978 0.977 0.977
Ensemble Norm 0.999 - - -
MFE -27.422 -37.242 -30.299 -32.698
Ligands - SAM SAM SAM
Gene ZNF808 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.006 3. 1.001
Length SE - 0. 0. 0.
Lev Distance - 29. 30. 31.
UBS 6. 7. 7. 7.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 0.
ILR 1. 0. 1. 1.
H 4. 5. 4. 4.
BL 2. 1. 1. 2.
BR 1. 1. 1. 1.
UN 0.173 0.096 0.173 0.202

Sequences

Field Description
UTR seq + 25 gcgcggagauuaacgcaaacccggaagcggaucggguggagugaaggucacgucgccauggauugauuucuaaagacucATGATGAAGGAGGTCTTGTCAACAG
UTR dot + 25 ..(((……..)))….(((….)))….(((((.((((…)))).)))))…(((.(((((((…………….)))))))..)))…..
RS 1 seq GUGCUACAUCAGGAGCGACCAUCAGGUCCGGCAACCGGGAAUCCACGGUGCCAAGUCAUUUCGGUGACGAUGUGGUCCCGCAAGGGACAACGGACCGCAUGGUG
RS 1 dot ..(((……..)))((((….)))).(((.((((((…)).)))))))..(((((….))))).(((((((((………….)))))))))….
RS 2 seq ACCUUAUCCAGAGAGGUGGAGGGACUGGCCCUAUGAAACCCGGCAACCGGCACGAAGUGCGCGGUGCUAAAUCCUGCAGCUGCGAAUUGGCUGAAAGAUGAGUU
RS 2 dot (((((…….)))))..((((…..))))………(((.((((((((…)))).)))))))..(((…(((((…….)))))…)))…..
RS 3 seq CGCUUAUAGAGAAAGGCAGAGGGACUAGACCCGAUGAAGCCUUAGCAACCUGUCCCUUGACAAGGUGCUAAAUUCUAUCCGCCAGCUGGCGGAAAAGAUAAGCC
RS 3 dot .((((……..))))…(((……)))………(((((.(((((((….)))).))))))))..(((.((((((….))))))..)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table