Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA123978 Similarity: 0.974 Similarity: 0.973 Similarity: 0.972
UTR: 5HSAA123978
Gene: ZNF808_0
MFE: -27.083
ENS: 0.994
Length: 106.
Predicted Ligands:
TPP - 8/20
glycine - 4/20
SAM - 4/20
 RS: URS0000ABC2AF_593907
MFE: -50.698
Ligand: methionine
Species: [Cellvibrio] gilvus ATCC 13127 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000D8AD9C_326522
MFE: -24.852
Ligand: glycine
Species: Neisseria animaloris Glycine riboswitch
 RS: URS0000D9C01E_515897
MFE: -43.232
Ligand: TPP
Species: alpha proteobacterium GRP21 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA123978 URS0000ABC2AF_593907 URS0000D8AD9C_326522 URS0000D9C01E_515897
Length 106. 107. 107. 105.
Similarity - 0.974 0.973 0.972
Ensemble Norm 0.994 - - -
MFE -27.083 -50.698 -24.852 -43.232
Ligands - methionine glycine TPP
Gene ZNF808 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 3.005 7.
Length SE - 1. 1. 1.
Lev Distance - 32. 34. 33.
UBS 9. 9. 9. 8.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 2.
ILR 2. 3. 2. 1.
H 3. 3. 3. 2.
BL 3. 2. 2. 3.
BR 2. 1. 3. 4.
UN 0.075 0.056 0.150 0.067

Sequences

Field Description
UTR seq + 25 uucaguccugggcgcgcaaaccccgaggcggaucgcguggagugaaggucguaccgcggcgcgauugauuucuaaagacucATGATGAAGGAGGTCTTGTCAACAG
UTR dot + 25 ((((.(((…(((((.(..(((…)).)..))))))))).)))).(((((…)))))..(((.(((((((…………….)))))))..)))…..
RS 1 seq GGUCAUGAGCGUCUCCGCCAAGCCCCGGCUGGGAGACCGGCAACCCUCCGUCCGUGGCGGGGUGCCCCGGGUGACGACCAGGCCGUCGUGCGCCGCGGGCGCCUACA
RS 1 dot (((..((.(.(((((((((…….)))..)))))))..)))))..(((((…)))))(((((((..(((((((((……))))).))))..)))))))….
RS 2 seq CAAACCGAUGCAGGAGAGUGCUACACCGUACUACAUCAACUGUACGGCAAGCCGCCGAAGGCGCAGACACCCUUAAAUCGCUCAGGCAAAAGGACUGCAUUUCAUCA
RS 2 dot ….(((.(((((..(((((.(((…))).))).))..))))))))…(((……)))((((….((((…((…..))…)))).))))………
RS 3 seq GGUCCCGCCUCGGGGAGCCCGUCACGGGCUGAGACGCGCACCCUGCGCGGACCCGUUGAACCUGAACCAGGUCGUGCUGGCGGAGGGAAGGUCCGGGUUCAUCCA
RS 3 dot ((((((((…((((.((.((((………)))).)).))))))).)))))…((((((((.(((…((((….))))……))).))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table