Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA123998 Similarity: 0.962 Similarity: 0.962 Similarity: 0.961
UTR: 5HSAA123998
Gene: ZNF821
MFE: -33.040
ENS: 0.929
Length: 144.
Predicted Ligands:
TPP - 6/20
FMN - 5/20
cobalamin - 3/20
 RS: URS0000AB4A09_633697
MFE: -38.323
Ligand: FMN
Species: Eubacterium cellulosolvens 6 FMN riboswitch (RFN element)
 RS: URS0000D8BFA4_1798388
MFE: -40.226
Ligand: FMN
Species: Candidatus Gottesmanbacteria bacterium RIFCSPLOWO2_01_FULL_39_12b FMN riboswitch (RFN element)
 RS: URS000232A934_1618791
MFE: -27.707
Ligand: cobalamin
Species: Parcubacteria group bacterium GW2011_GWA1_47_10 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA123998 URS0000AB4A09_633697 URS0000D8BFA4_1798388 URS000232A934_1618791
Length 144. 145. 146. 144.
Similarity - 0.962 0.962 0.961
Ensemble Norm 0.929 - - -
MFE -33.040 -38.323 -40.226 -27.707
Ligands - FMN FMN cobalamin
Gene ZNF821 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.012 2.004 12.019
Length SE - 1. 4. 0.
Lev Distance - 46. 45. 48.
UBS 9. 9. 9. 6.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 1.
ILR 1. 1. 1. 0.
H 5. 5. 4. 5.
BL 0. 2. 1. 0.
BR 1. 3. 1. 0.
UN 0.146 0.255 0.205 0.285

Sequences

Field Description
UTR seq + 25 ggggaaaaugacaugugcuaacaauaaccuuuuuuauugcagguuagcaucuugcaaggagguaguaacauauccagucgugaaacugggaaagaccagagcucuugcaucagggaaacATGTCCCGTCGGAAACAGACAAATC
UTR dot + 25 …….((((((((((((…….((((((….(((((((…….))))))))))))))))).)))…..)))))….((((……)))).((….))….((((……))))(((…….)))…..
RS 1 seq CAAGAUCUUCAGGGCGGGGCGAAAUUCCCCACUGGCGGUGAUACUCCUUUGUUUGGAAAGUGAGCAAGUCCGCGAGCGGCCUUCGGGCGGCAGAACCGGUGAGAAUCCGGUACCAACAGUAAAGUCUGGAUGAAAGAAGACACAG
RS 1 dot ……………((((…….)))).((.((((…..(((((((……)))).)))…..)))).))((.((…)).))…..(((((…….)))))…………((((……….))))….
RS 2 seq AUAUUUCUUCGGGGUUAGAUGCAAGUUCUGAUCGGUGGUAAACCCCUAGUUAAGGUCGGGGCAAGCCCACGAGUUCUGAGAUAAUCGGGACACGAUCUGGUGUAAUUCCAGGGCCGACCGUAUAGUCGGGACGAAAGAAGGAAAAA
RS 2 dot ……..((((((((…(((….(((((((((.((….))))…….))))))))))))))).)))(((((((…..)))))))….(((((…….))))).(((((……)))))……………..
RS 3 seq UGUAAGUAUAUACUAAGUAGGUUCCUUUUAAAAAAUUCAAAGAAAUGGGUUGGGGAAACCGGUGAGAUUCCGGUACAGUGCCGCUACGGUAAGCCUCGUCAAACGAGGACAAGUCCGACUACCAUUCAUUUCUAAGUCCCGAGC
RS 3 dot …………………((((((……((((((……))))))))))))(((((…….)))))….(((((…)))))..((((((…))))))……..((((…………..))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table