Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA124146 Similarity: 0.920 Similarity: 0.917 Similarity: 0.916
UTR: 5HSAA124146
Gene: ZRANB3
MFE: -64.308
ENS: 0.903
Length: 237.
Predicted Ligands:
cobalamin - 17/20
FMN - 1/20
glucosamine - 1/20
 RS: URS000231B527_29570
MFE: -78.147
Ligand: cobalamin
Species: Halomonas meridiana Cobalamin riboswitch
 RS: URS0000ABA15B_211586
MFE: -72.364
Ligand: FMN
Species: Shewanella oneidensis MR-1 FMN riboswitch (RFN element)
 RS: URS000231B662_28066
MFE: -90.820
Ligand: cobalamin
Species: Rhodoferax fermentans Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA124146 URS000231B527_29570 URS0000ABA15B_211586 URS000231B662_28066
Length 237. 235. 237. 237.
Similarity - 0.920 0.917 0.916
Ensemble Norm 0.903 - - -
MFE -64.308 -78.147 -72.364 -90.820
Ligands - cobalamin FMN cobalamin
Gene ZRANB3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.001 23.004 13.
Length SE - 4. 0. 0.
Lev Distance - 94. 96. 104.
UBS 15. 17. 17. 15.
BS 0. 0. 0. 0.
ILL 2. 4. 5. 4.
ILR 3. 3. 4. 3.
H 4. 5. 6. 4.
BL 6. 6. 5. 6.
BR 7. 6. 5. 4.
UN 0.097 0.128 0.160 0.114

Sequences

Field Description
UTR seq + 25 ccuuuucgcaacccuaacgggagagaagugauggaagaaggguagccggaagaguuuccucaaaauaccauagggguuuuaaauuauuaguacguauuuaaacucaucuacuuucacguugucccguugaacgucacuuccgcuuaggggcggacacgucccaaaccuguggcgggaguuggagauucugcggcgaauacgccaggaucaucATGTGGGGAATGTTGAATCGCAAGG
UTR dot + 25 …………..((((((((.((..((((.((.(((.((((((((((((….))))……………))))…………………..)))).))).)).)))).)).))))))))……((((((((((.((((((….)))))).)……)))))))))(((.((((((..((((….)))))))))).)))(((((………..)))))…
RS 1 seq AGUUUACUCGCACUCUCAGGUGCUGGUGGCGCGAACGCCAUCAGUUAAACGGGAAGUUGGUGAACGCUUUUUGUGAAUCCAACGCUGCCCCCGCAACGGUGAUCGAGAUAAGAACGGCUAGAGACGCCACUGUGCUUACGCAUGGGAAGGUGGUCGUUCGGAAAGGUAUGGCGCUUACGUUAAGCCGCCCCUUUCGCUCGUCAGCCCGGAGACCGGCCUAAGAGUGACGGCUAAA
RS 1 dot .(((((((.((..((((….((((((((((….))))))))))…..)))).)).)))))))…………..((.((.(((….))).)).))……….(((((((……((((.((((((….))))))…))))))))))).((((((…((((((((…))))).)))))))))((.((((((.((((…)))).))……))))))….
RS 2 seq AACAAUUCUCAGGGCGGGGUGAAACUCCCCACCGGCGGUAAAUAGUGAGGUAAAAGAGAUUUUCCCACGCUAAAGCCCGCGAGCGCCCGAACGCAAUUUCGGGGUCAGCAGAUCUGGUGCCCUAGCAUGUCUCGCCAUGGUUAACGCCAAACGAGACCGCGCUAUUAUUCCAGAGCCGACGGUAAUGGACUGUUUGCCACUAGCGACAGUACUGAGUCCGGAUGGAAGAGAAUGUAA
RS 2 dot …………((.((((…….)))).)).((((….(((((.((.((((….)))).)).)))))….))))…..((((((……))))))(((.((…(((((…..((((..((((((…((((….))))..))))))…))))…..))))))).)))……((((((.((((…..)))))))).))…(((….)))………..
RS 3 seq CGUUAGAAUCGGGCCGUUGGUGCUCGCGCCGUGGUUCACACAGCGCAGUUCAACGGGAAGCAGGAGGGGGCGGCUUGAACGAGCUCAACCUAACCUGCGCUGCCCCCGCAACGGUAAGUGGACGAAUCUAUUCGGUUCUGCUGCCAUCAAGGCCACUGGAUGUCGUGACAGACAUUUGGGAAGGUGAUGGCGGUUGACUCCACCAGCCCGGAUACCGGCCAACACGGUGGCUGCAUG
RS 3 dot ………….(((((((.(((.((((.(((…..))).))))))))))))))…….(.(((((((((((((……))))……….))))))))).)…(((..(((((…………(((..(((((((((…(((.(((((((((……)))))))))…)))))))))))).))))))))..)))(((.(((((…….))))).)))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table