Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA124147 Similarity: 0.986 Similarity: 0.986 Similarity: 0.986
UTR: 5HSAA124147
Gene: ZRANB3_0
MFE: -20.499
ENS: 0.877
Length: 98.
Predicted Ligands:
TPP - 20/20 - 20/20


 RS: URS0000AB3FF6_762984
MFE: -23.640
Ligand: TPP
Species: Bacteroides clarus YIT 12056 TPP riboswitch (THI element)
 RS: URS0000AB7D2A_1263049
MFE: -23.640
Ligand: TPP
Species: Bacteroides intestinalis CAG:564 TPP riboswitch (THI element)
 RS: URS0000ABD5AD_1263055
MFE: -23.640
Ligand: TPP
Species: Bacteroides uniformis CAG:3 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA124147 URS0000AB3FF6_762984 URS0000AB7D2A_1263049 URS0000ABD5AD_1263055
Length 98. 97. 97. 97.
Similarity - 0.986 0.986 0.986
Ensemble Norm 0.877 - - -
MFE -20.499 -23.640 -23.640 -23.640
Ligands - TPP TPP TPP
Gene ZRANB3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 7. 7.
Length SE - 1. 1. 1.
Lev Distance - 16. 16. 16.
UBS 6. 5. 5. 5.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 1. 1. 1. 1.
H 3. 3. 3. 3.
BL 2. 0. 0. 0.
BR 1. 0. 0. 0.
UN 0.194 0.206 0.206 0.206

Sequences

Field Description
UTR seq + 25 uuguaaaagagcuaccuuuucccacgaguuggagccugaggugcggaguuucgugaguuuuuacugacucgagATGTGGGGAATGTTGAATCGCAAGG
UTR dot + 25 ……….((.(((((((((……..))))…)))))))……((.((((((……)))))).))(((((………..)))))…
RS 1 seq AUUUCAACUAAGGGGUGCCCUAAUAUGACGGGCUGAGAACAUACCCAUUGACCUGAUCCGGGUAGUGCCGGCGGAGGGAAAAGAAGAAAAGUUCCCC
RS 1 dot …………((((((((………))))………))))……(((..((((……))))))).(((((………..))))).
RS 2 seq AUUUCAACUAAGGGGUGCCCUAAUAUGACGGGCUGAGAUCAUACCCAUUGACCUGAUCCGGGUAGUGCCGGCGGAGGGAAAAGAAGAAAAGUUCCCC
RS 2 dot …………((((((((………))))………))))……(((..((((……))))))).(((((………..))))).
RS 3 seq AUUUCAACUAAGGGGUGCCCUAAUACGACGGGCUGAGAUCAUACCCAUUAACCUGAUCCGGGUAAUGCCGGCGGAGGGAAAAGAAGAAAAGUUCCCC
RS 3 dot …………((((((((………))))………))))……(((..((((……))))))).(((((………..))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table