Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA124300 Similarity: 0.984 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA124300
Gene: ZZZ3
MFE: -14.846
ENS: 0.746
Length: 76.
Predicted Ligands:
homocysteine - 4/20
cobalamin - 4/20
glycine - 4/20
 RS: URS0000BF4869_864702
MFE: -20.601
Ligand: glutamine
Species: Oscillatoriales cyanobacterium JSC-12 Glutamine riboswitch
 RS: URS0000D7F33F_1945854
MFE: -33.287
Ligand: homocysteine
Species: Rhodanobacter sp. C06 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000BFB278_891974
MFE: -20.448
Ligand: fluoride
Species: Plautia stali symbiont Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA124300 URS0000BF4869_864702 URS0000D7F33F_1945854 URS0000BFB278_891974
Length 76. 76. 76. 75.
Similarity - 0.984 0.984 0.984
Ensemble Norm 0.746 - - -
MFE -14.846 -20.601 -33.287 -20.448
Ligands - glutamine homocysteine fluoride
Gene ZZZ3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.006 10.004 10.001
Length SE - 0. 0. 1.
Lev Distance - 19. 18. 17.
UBS 7. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 1. 1. 1. 1.
H 2. 2. 2. 2.
BL 5. 3. 2. 2.
BR 2. 1. 2. 2.
UN 0.197 0.276 0.132 0.227

Sequences

Field Description
UTR seq + 25 guuucccaaugaguggaucaugaugaccguauuguagggacuugccauaguATGATAGATCTTTGGTTGTACAGTT
UTR dot + 25 …((((.((((.(((.(((…))))))..)))).))))…((((.((.((…..)))).))))………
RS 1 seq AUCGUUCAUCUCCUCUCUAGUGCUUCUCAAGCCUCAAGGGAGACGGAAGUAGGGAGACAUCCCGAAGGAACGCGCC
RS 1 dot ….(((.(((((.((..((.((((…))))))..))))))).)))….((((….))))………….
RS 2 seq CGGGCCGAGGGGUGCUGCGACGGAGCGAUCCGCCACGCUCGGCCCGCGAUCCUCGAGACAAGGGCGCCCUCCAUGC
RS 2 dot .(((((((((((((.(((……)))…)))).).))))))))(((.((((…….)))))))………
RS 3 seq UGCCUCUGAGGUGAUGGCGUGCCACCUUACCCAACCGCCCUCAGGUCACAGACGGCUGAUGACGCCUGACAACUU
RS 3 dot …..((((((((.(((.(((……))))))..)))).))))(((((((….))).))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table